Primers

We provide the following primers:

T7 Promotor: 5'- gtaatacgactcactataggg -3'
T3: 5'- attacccctcactaaag -3'
SP6: 5'- tacgatttaggtgacactata g -3'
M13fwd(-21): 5'- tgtaaaacgacggccagt-3'
M13rev: 5'- ggaaacagctatgaccatg-3'
KS: 5'- tcgaggtcgacggtatc-3'
SK: 5'- ctaggtgatcaagatctcgc-3'
T7 Terminator: 5'- gctagttattgctcagcgg-3'

We also have a special primer that anneals to poly (A) regions of cDNA clones that are 25 bases or longer. Taq frequently "slips" on these regions and we've found that this primer significantly improves the quality of those sequences. If you have a cDNA clone, you might want to consider using this primer. It's sequence is: 5'-TTT TTT TTT TTT TTT TTT TTT TTT T(A,C, g) -3'  

If you want us to use your own primers:
Please dilute them to 1.6µM (1.6pmol/ul) with ddH2O and provide 4ul for every reaction.

The best primer parameters are: 
Tm= 56C to 65C, 
%G/C= ~ 50%
At least 18 bases long.